View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_high_40 (Length: 269)
Name: NF3576_high_40
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 151 - 252
Target Start/End: Complemental strand, 48230055 - 48229954
Alignment:
| Q |
151 |
aaaaaacattcaaagtgttttgtgtttgaaagttgagagtaccgtgtgtcatgaagtagaaagaatattaacctgttaagtaagttacaaactcagcttt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48230055 |
aaaaaacattcaaagtgttttgtgtttgaaagttgagagtgccgtgtgtcatgaagtagaaagaatattaacctgttaagtaagttacaaactcagcttt |
48229956 |
T |
 |
| Q |
251 |
ct |
252 |
Q |
| |
|
|| |
|
|
| T |
48229955 |
ct |
48229954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 48230205 - 48230150
Alignment:
| Q |
1 |
gtgggtggtggtgttgaacttgaagaccttcctcttcctcctctcttctccacaag |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48230205 |
gtgggtggtggtgttgaacttgaagaccttcctcttcctcctctcttctccacaag |
48230150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University