View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3576_high_61 (Length: 236)

Name: NF3576_high_61
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3576_high_61
NF3576_high_61
[»] chr1 (1 HSPs)
chr1 (18-212)||(50865056-50865254)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 18 - 212
Target Start/End: Complemental strand, 50865254 - 50865056
Alignment:
18 aattagctagggtcaattaacataataagcgattgaatttgaagaataaaggaagagaagagaaga-----tattattgactcactgattgtacaagtga 112  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||    
50865254 aattagctagg-tcaattaacataataagcgattgaatttgaagaataaaggaagagaagagaagagaagatattattgactcactgattgtacaagtga 50865156  T
113 taagaaaggcggaatgagaatgagtgagaagagaagacggagcattgtagtcaaaccgaggaagtctgattacgctcgaatgctgctcccatggcttcat 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50865155 taagaaaggcggaatgagaatgagtgagaagagaagacggagcattgtagtcaaaccgaggaagtctgattacgctcgaatgctgctcccatggcttcat 50865056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University