View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_high_62 (Length: 235)
Name: NF3576_high_62
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_high_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 34 - 216
Target Start/End: Complemental strand, 38457954 - 38457771
Alignment:
| Q |
34 |
ccataaagttagacaaggaacatattgaaaaggttggaaggaagcagatattgatttcaactaa-tgtaagaatttggaaatctctcatacaaaatttct |
132 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38457954 |
ccataaagttagacaagtaacatattgaaaaggttgaaaggaagcagatcttgatttcaactaaatgtaagaatttggaaatctctcatacaaaatttct |
38457855 |
T |
|
| Q |
133 |
tattctacaaatacttatttgaaaaatttatccaaggttactctaaaacacataaaagaagtaaatgttgttaaataacagcta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38457854 |
tattctacaaatacttatttgaaaaatttatccaaggttactctaaaacacataaaagaagtcaatgttgttaaataacagcta |
38457771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 187
Target Start/End: Complemental strand, 38459598 - 38459554
Alignment:
| Q |
143 |
atacttatttgaaaaatttatccaaggttactctaaaacacataa |
187 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
38459598 |
atacttatttgaaaaaattattttaggttactctaaaacacataa |
38459554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University