View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_high_66 (Length: 224)
Name: NF3576_high_66
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_high_66 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 5 - 97
Target Start/End: Complemental strand, 27147327 - 27147235
Alignment:
| Q |
5 |
cacctcctttcctcctgaattttctctctagagatagattagggatgccatttactagatttcatatgtcttgattgtttccatccctcctga |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27147327 |
cacctcctttcctcctgaattttctctctagagatagattagggatgccatttactagatttcatatgtcttgattgtttccctccctcctga |
27147235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Complemental strand, 27147155 - 27147120
Alignment:
| Q |
178 |
catctcctgacttttatattgaatttctagctttat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27147155 |
catctcctgacttttatattgaatttctagctttat |
27147120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 12 - 97
Target Start/End: Original strand, 9383148 - 9383233
Alignment:
| Q |
12 |
tttcctcctgaattttctctctagagatagattagggatgccatttactagatttcatatgtcttgattgtttccatccctcctga |
97 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9383148 |
tttcctccttaattttctctctagagatagattagggatgccatttactagatttcatatgtcttgattgtttccctccctcctga |
9383233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 178 - 213
Target Start/End: Original strand, 9383304 - 9383339
Alignment:
| Q |
178 |
catctcctgacttttatattgaatttctagctttat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9383304 |
catctcctgacttttatattgaatttctagctttat |
9383339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 11 - 97
Target Start/End: Complemental strand, 44301921 - 44301835
Alignment:
| Q |
11 |
ctttcctcctgaattttctctctagagatagattagggatgccatttactagatttcatatgtcttgattgtttccatccctcctga |
97 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
44301921 |
ctttcctccttaattttctctctagagatagattagggatgccatttactagatttcataagtcttgattgtttccctccctcctga |
44301835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 11 - 94
Target Start/End: Complemental strand, 15484164 - 15484081
Alignment:
| Q |
11 |
ctttcctcctgaattttctctctagagatagattagggatgccatttactagatttcatatgtcttgattgtttccatccctcc |
94 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15484164 |
ctttcttccttaattttctctctagagatagattagggatgccatttactagatttcatatgtcttgattgtttccctccctcc |
15484081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 213
Target Start/End: Complemental strand, 15483997 - 15483958
Alignment:
| Q |
174 |
caggcatctcctgacttttatattgaatttctagctttat |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15483997 |
caggcatcacctgacttttatattgaatttctagctttat |
15483958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 11 - 94
Target Start/End: Original strand, 30731652 - 30731735
Alignment:
| Q |
11 |
ctttcctcctgaattttctctctagagatagattagggatgccatttactagatttcatatgtcttgattgtttccatccctcc |
94 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30731652 |
ctttcttccttaattttctctctagagatagattagggatgccatttactagatttcatatgtcttgattgtttccctccctcc |
30731735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 213
Target Start/End: Original strand, 30731819 - 30731858
Alignment:
| Q |
174 |
caggcatctcctgacttttatattgaatttctagctttat |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30731819 |
caggcatcacctgacttttatattgaatttctagctttat |
30731858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University