View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_high_70 (Length: 207)
Name: NF3576_high_70
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_high_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 22217647 - 22217819
Alignment:
| Q |
18 |
tgatgggtatgtttgaatttggtggaggaacgttttcaagattggatttagggtttgaagaaatgggtttgcgaaaggatgaaattggaagaaggttttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
22217647 |
tgatgggtatgtttgaatttggtggaggaacgttttcaagattggatttagggtttgaagaaatgggtttacggaaggatgaaattggaagaaggttttt |
22217746 |
T |
|
| Q |
118 |
gattgaagttgaagtgaaggttccgaagaaactattatc---gttgttattgttgttctttggcttcattgtt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
22217747 |
gattgaagttgaagtgaaggttccgaagaaactgttatcgttgttgttgttgttgttctttggcttcattgtt |
22217819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 40 - 87
Target Start/End: Original strand, 8985360 - 8985407
Alignment:
| Q |
40 |
tggaggaacgttttcaagattggatttagggtttgaagaaatgggttt |
87 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8985360 |
tggagcaatgttttcaagattggatttagggtttgaagaaattggttt |
8985407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University