View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_high_72 (Length: 204)
Name: NF3576_high_72
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_high_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 60 - 189
Target Start/End: Complemental strand, 5713393 - 5713265
Alignment:
| Q |
60 |
cggggtgtggggggtatagaaatgatggtgtggaattcatgtagacggattaatagaaatctaagagtcattgagagagagtgaggctagttgatccgcc |
159 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5713393 |
cggggtttggggggtatagaaatgatggtgtggaattcatgtagacggattaatagaa-tctaagagtcattgagagagagtgaggctagttgatccgcc |
5713295 |
T |
 |
| Q |
160 |
gggctgtttccttgctgttgaccaacattt |
189 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |
|
|
| T |
5713294 |
gggctgtttccttgctgttgactaacattt |
5713265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University