View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_23 (Length: 356)
Name: NF3576_low_23
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 144 - 353
Target Start/End: Original strand, 29395111 - 29395320
Alignment:
| Q |
144 |
ttcatataactacaaattttccttcaaatattcgatggctctcatcattaacctccccattggaacaccacctcaaactcaaccaatggtgttggacacc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29395111 |
ttcatataactacaaattttccttcaaatattcgatggctctcatcattaacctccccattggaacaccacctcaaactcaaccaatggtgttggacact |
29395210 |
T |
 |
| Q |
244 |
ggtagccaactttcatggattcagtgtcacaaaaaacaacctccaacagcatcctttgatccttctctctcttcaactttctctatcctcccttgtactc |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29395211 |
ggtagccaactttcatggattcagtgtcacaaaaaacaacctccaacagcatcctttgatccttctctctcttcaactttctctatcctcccttgtactc |
29395310 |
T |
 |
| Q |
344 |
accctctctg |
353 |
Q |
| |
|
|||||||||| |
|
|
| T |
29395311 |
accctctctg |
29395320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 51 - 94
Target Start/End: Original strand, 29395027 - 29395070
Alignment:
| Q |
51 |
caatgacacaacctcaaaaatgctatacacatctcaactatttt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29395027 |
caatgacacaacctcaaaaatgctatacacatctcaactatttt |
29395070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 199 - 275
Target Start/End: Original strand, 33250421 - 33250497
Alignment:
| Q |
199 |
cccattggaacaccacctcaaactcaaccaatggtgttggacaccggtagccaactttcatggattcagtgtcacaa |
275 |
Q |
| |
|
|||||||| |||||||| || ||||| |||||| || ||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
33250421 |
cccattggcacaccaccacagcttcaacaaatggttttagacacaggaagccaactttcatggattcaatgtcacaa |
33250497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 199 - 275
Target Start/End: Original strand, 33264513 - 33264589
Alignment:
| Q |
199 |
cccattggaacaccacctcaaactcaaccaatggtgttggacaccggtagccaactttcatggattcagtgtcacaa |
275 |
Q |
| |
|
||||||||||||||||| || ||||| |||||| ||||| || || |||||| ||||||||||||| ||| |||| |
|
|
| T |
33264513 |
cccattggaacaccaccacagcttcaacaaatggttttggatacaggaagccaagtttcatggattcactgtgacaa |
33264589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 199 - 275
Target Start/End: Original strand, 50236917 - 50236994
Alignment:
| Q |
199 |
cccattggaacaccacctcaaactcaaccaatgg-tgttggacaccggtagccaactttcatggattcagtgtcacaa |
275 |
Q |
| |
|
|||||||| |||||||| ||| ||||| ||||| | ||||| || || |||||| |||||||||||||||||||||| |
|
|
| T |
50236917 |
cccattggcacaccaccacaacttcaacaaatgggtattggatacaggaagccaaatttcatggattcagtgtcacaa |
50236994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University