View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_33 (Length: 309)
Name: NF3576_low_33
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 221 - 292
Target Start/End: Complemental strand, 24941999 - 24941928
Alignment:
| Q |
221 |
cgtaatccaaaaatacaacatatgtcggcattgaagcgcatcattcactatattcagggcattattgatccc |
292 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24941999 |
cgtaatccaaaaacacaacatatgtcggcattgaagcgcgtcattcactatattcagggcattattgatccc |
24941928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University