View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_36 (Length: 298)
Name: NF3576_low_36
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 176 - 282
Target Start/End: Complemental strand, 31583950 - 31583844
Alignment:
| Q |
176 |
catcattcaacatcaaattagtaaaatctatgtttaggtaatcctaacttatttctatgaaaatccttcgtaataacatttggaagattgccctaccgag |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31583950 |
catcattcaacatcaaattagtaaaatctatgtttaggtaatcctaacttatttctatgaaaatccttcgtaataacatttggaagattgccctaccgag |
31583851 |
T |
 |
| Q |
276 |
tgaaact |
282 |
Q |
| |
|
||||||| |
|
|
| T |
31583850 |
tgaaact |
31583844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 16 - 119
Target Start/End: Complemental strand, 31584110 - 31584007
Alignment:
| Q |
16 |
atcattaataaaagtaaaaaatgcacaaacttagatgaactaaaccaaacccaaagcaatacacaaggtgaatgctaatctctacttcattagaaacctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31584110 |
atcattaataaaagtaaaaaatgcacaaacttagatgaactaaaccaaacccaaagcaatacacaaggtgaatgctaatctctacttcattagaaacctt |
31584011 |
T |
 |
| Q |
116 |
cccc |
119 |
Q |
| |
|
|||| |
|
|
| T |
31584010 |
cccc |
31584007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University