View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_42 (Length: 268)
Name: NF3576_low_42
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 258
Target Start/End: Complemental strand, 7260272 - 7260034
Alignment:
| Q |
20 |
cactggcaccagggtgagtgtgaagtgggataacaccagcaggaccaaggtctaaccttgctgcagagagaccaagaccattaacagctggaaattgagc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260272 |
cactggcaccagggtgagtgtgaagtgggataacaccagcaggaccaaggtctaaccttgctgcagagagaccaagaccattaacagctggaaattgagc |
7260173 |
T |
|
| Q |
120 |
aacaaatgcaggtgtaacggcggcgttgataatgtttgttatgtttccaggtgcaattaagccttcaaatgcaaagtcatctgaggttactgttgaagct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260172 |
aacaaatgcaggtgtaacggcggcgttgataatgtttgttatgtttccaggtgcaattaagccttcaaatgcaaagtcatctgaggttactgttgaagct |
7260073 |
T |
|
| Q |
220 |
ggcttgcaagggtagcctgaaggagtgtctaagcctttg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7260072 |
ggcttgcaagggtagcctgaaggagtgtctgagcctttg |
7260034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 67 - 131
Target Start/End: Complemental strand, 7266052 - 7265988
Alignment:
| Q |
67 |
aggtctaaccttgctgcagagagaccaagaccattaacagctggaaattgagcaacaaatgcagg |
131 |
Q |
| |
|
|||||||| ||||||| || | |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7266052 |
aggtctaattttgctgctgataaaccaagaccattaacagctggaaattgattaacaaatgcagg |
7265988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University