View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_45 (Length: 261)
Name: NF3576_low_45
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 35803784 - 35804009
Alignment:
| Q |
18 |
caaaccctactccctatactcaattccagatttatcattttgtttttgtcccttcctttcagaagagaaaaacaaaattcaagccaactttttaattcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35803784 |
caaaccctactccctatactcaattccagatttatcattttgtttttgtcccttcctttcagaagagaaaaacaaaattcaagccaactttttaattcaa |
35803883 |
T |
 |
| Q |
118 |
aattgcattatttttgttatcannnnnnnnnnatcagttgcaacttttaaggctctttaacttgccttttgataatgtggttttatttcttaaaatccct |
217 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35803884 |
aattgcattatttttgttgtca--ttttttttatcagttgcaatttttaaggctctttaacttgccttttgataatgtggttttatttcttaaaatccct |
35803981 |
T |
 |
| Q |
218 |
ttacaaaagcttgttttctaatattctt |
245 |
Q |
| |
|
||||||||| |||||||||||| ||||| |
|
|
| T |
35803982 |
ttacaaaagtttgttttctaattttctt |
35804009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 49 - 239
Target Start/End: Complemental strand, 55695874 - 55695696
Alignment:
| Q |
49 |
ttatcatt-ttgtttttgtcccttcctttcagaagagaaaaacaaaattcaagccaactttttaattcaaaattgcattatttttgttatcannnnnnnn |
147 |
Q |
| |
|
|||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55695874 |
ttatcattcttgcttttgtcctttcctttcagaagagaaaaacaaaattcaagccaactttttaaatcaaaattgcattatttttgt------------- |
55695788 |
T |
 |
| Q |
148 |
nnatcagttgca-acttttaaggctctttaacttgccttttgataatgtggttttatttcttaaaatccctttacaaaagcttgttttctaat |
239 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||| | ||||||||||| |
|
|
| T |
55695787 |
-cattagttgcagttttttaaggctctttaacttgccgtttgataatgtggttttatttcataaaatccctttccaaaaacatgttttctaat |
55695696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University