View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_46 (Length: 252)
Name: NF3576_low_46
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 78 - 237
Target Start/End: Complemental strand, 14276811 - 14276653
Alignment:
| Q |
78 |
caaaccatcaactttaggtaagcaagtaagaatcttatttttacttttatgtattcatgaacaatcaagagtctctccggattttcaatgttattatttt |
177 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
14276811 |
caaaccatcaactt-aggtaagcaagtaagaatcttatttttacttctatgtattcatgaacaatcaaaagtctctcgggattttcaatgttattatttt |
14276713 |
T |
|
| Q |
178 |
attaatcgctagttctgtgtttatattgctgagacttttgaacattaattaggtgttatt |
237 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14276712 |
attaatcggtagttctgtgtttatattgctgagacttttgaacattgtttaggtgttatt |
14276653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University