View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_51 (Length: 249)
Name: NF3576_low_51
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 3646087 - 3646317
Alignment:
| Q |
1 |
ataccataaccccaatctctaccctgatgatcttgtatgtaaacaaggaccgtcactgccataagagatcctaggtttacgatgaagtaataccaattga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3646087 |
ataccataaccccaatctctaccctgatgatcttgtatgtaaacaaggaccgtcaccgccataagagatcctaggtttacgatgaagtaataccaattga |
3646186 |
T |
 |
| Q |
101 |
gaaatttaaccatatgtttcttctcttctttatcagtagcatcaaattgatctgaaccaaagccagggacactggattttaaaccccctgtgccaagtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3646187 |
gaaatttaaccatatgtttcttctcttctttatcagtagcatcaaattgatctgaaccaaagccagggacactggattttaaaccccctgtgccaagtgc |
3646286 |
T |
 |
| Q |
201 |
agtgacataaagcgctaaaaacagaactgtt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3646287 |
agtgacataaagcgctaaaaacagaactgtt |
3646317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 219
Target Start/End: Original strand, 3658659 - 3658738
Alignment:
| Q |
140 |
catcaaattgatctgaaccaaagccagggacactggattttaaaccccctgtgccaagtgcagtgacataaagcgctaaa |
219 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||| ||||||| ||| || ||||| || || |||| |||||| |||||| |
|
|
| T |
3658659 |
catcaaattgatcggaaccaaagccagagacactagattttagaccgccagtgccgagggctgtgatataaagtgctaaa |
3658738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University