View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_57 (Length: 241)
Name: NF3576_low_57
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 54266414 - 54266617
Alignment:
| Q |
18 |
acgcaaatgtcaattgttactatgagttaacacgaatccacaaataaaggatagcaattttaattaaaaaaggaatttaaatgcacaaaatctatttgtt |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54266414 |
acgcaaatgtcaaatgttactatgagttaacccgaatccacaaataaag-----caattttaattaaaaaaggaatttaaatgcacaaaatctatttgtt |
54266508 |
T |
 |
| Q |
118 |
taaaatcaaatttactatttttaagataataatttatgctaaaccatacatttagtttcagacgcaagatggtatagttggttcgttcaaggatttggtc |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54266509 |
taaaatcaaatttactatttttatgataataatttatgctaaaccatacatttagtttcagacgcaagatggtatagttggttcgttcaaggatttggtc |
54266608 |
T |
 |
| Q |
218 |
ttcatcctg |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
54266609 |
ttcatcctg |
54266617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University