View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_71 (Length: 210)
Name: NF3576_low_71
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_71 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 36199550 - 36199730
Alignment:
| Q |
17 |
atatgtaagtagtagttttctttcatgtccgttgtttcgtaagattctaccataaaattgttgaatttgatggtttgagctatgaatatcatacacaatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36199550 |
atatgtaagtagtagttttctttcatgtccgttgtttcgtaagtttctaccataaaattgttgaatttgatggtttgagctatgaatatcatagacaatg |
36199649 |
T |
|
| Q |
117 |
taattac-acttatgcaaaactttgatggtcaatttcaatacagagttaatcaaataagattatgtaaaatactcttcaat |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36199650 |
taattactacttatgcaaaactttgatggtcaatttcaacacagagttaatcaaataagaatatgtaaaatactcttcaat |
36199730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University