View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3576_low_74 (Length: 206)
Name: NF3576_low_74
Description: NF3576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3576_low_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 14 - 187
Target Start/End: Original strand, 32770147 - 32770320
Alignment:
| Q |
14 |
gcagagagatcaacgaggaatacggcaaacacctacatggggttgtagacaagttgtgtaaaaacttgtcaatagggttagggcttgaaggtcatgagct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32770147 |
gcagagagatcaacgaggaatacggcaaacacctacatggggttgtagacaagttgttcaaaaacttgtcaatagggttagggcttgaaggtcatgagct |
32770246 |
T |
 |
| Q |
114 |
aaaggagtatgcagggggtgataacatggttcacttgttaaagatcaactattacccaccttgcccctgtcctg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32770247 |
aaaggagtatgcagggggtgataacatggttcacttgttaaagatcaactattacccaccttgcccctgtcctg |
32770320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University