View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3577_high_15 (Length: 291)
Name: NF3577_high_15
Description: NF3577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3577_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 274
Target Start/End: Complemental strand, 7647968 - 7647709
Alignment:
| Q |
16 |
ataattgtcacatattataacttttatctgcacttatgttatctaatttcaattgtatcaattagataataatttagannnnnnnaaattaatcaagata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7647968 |
ataattgtcacatattataacttttatctgcacttatgttatctaatttcaattgtatcaattagataataatttagatttttttaaattaatcaagata |
7647869 |
T |
 |
| Q |
116 |
ttttgcaaacgcttaacataacaaggatatttataacaaattcgtgaaataacaaaagtatctgtattagtggatatctactgctaaacttcatatgcag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7647868 |
ttttgcaaacgcttaacataacaaggatatttataacaaattcgtgaaataacaagagtatttgtattagtggatatctactgctaaacttcatatgcag |
7647769 |
T |
 |
| Q |
216 |
cgcaaatggaactggtatg-aagggggagacattatggtaaagaaaaatatgatttggac |
274 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| | |||||||||||| |||||||||| |
|
|
| T |
7647768 |
cgcaaatggaactggtatgaaaggggaagacattgtagtaaagaaaaatgtgatttggac |
7647709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University