View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3577_high_19 (Length: 245)
Name: NF3577_high_19
Description: NF3577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3577_high_19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 39 - 245
Target Start/End: Original strand, 44116891 - 44117097
Alignment:
| Q |
39 |
gattttataacactcatttgaaggagtggattaaatcatttactctagctcccttgccaatttgtttgtgtctatgtgttggaaattgtgactaccccgc |
138 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
44116891 |
gattttatagcactcatttgaaggagtggattaaatcatttactctagcttccttgccaatttgtttgtgtctatgtgttggaaatggtgactagcccgc |
44116990 |
T |
 |
| Q |
139 |
aacactgccattttctagaactccagttgggttagtaggctaggcgaattgatggtattatattaatttgttagtatttcctagaggtgagaatcgaacc |
238 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
44116991 |
aacactgccattttccagaactccagttgggttagtaggctaggcgaattgatggtattatattaatttgttagtatttgctagaggtgagaaccgaacc |
44117090 |
T |
 |
| Q |
239 |
gagacca |
245 |
Q |
| |
|
||||||| |
|
|
| T |
44117091 |
gagacca |
44117097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University