View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3577_low_12 (Length: 352)
Name: NF3577_low_12
Description: NF3577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3577_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 43 - 330
Target Start/End: Original strand, 26833606 - 26833894
Alignment:
| Q |
43 |
acatcatcaacgacatgcctaggcaaagaaacactgcaactctcagcaatggcacgatcaatggctctctgatttgtctccaacgaaactcgagttgtaa |
142 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
26833606 |
acatcatcaacgacatgcctaggcaaacaaacactgcaactctcagcaatggcacgatcaatggctctctgatttgtctccaaagaaactcgtgttgtaa |
26833705 |
T |
|
| Q |
143 |
accaagtccattccttgctccttgaaaagcatacannnnnnnacttcaaatgnnnnnnngaataaatttaaccaactttacttaaagaaaaggagaaaaa |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26833706 |
accaagtccattccttgctccttgaaaagcatacatttttttacttcaaatgtttttttgaataaatttaaccaactttacttaaagaaaaggagaaaaa |
26833805 |
T |
|
| Q |
243 |
cttgtttttgtttcca-gggtcatgcagaaaagaaactgtggaagaggtagaaaaattaacaaaacgttgatatgcttgaagatctaag |
330 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26833806 |
cttgtttttgtttccaggggtcatgcagaaaagaaactgtgaaagaggtagaaaaattaacaaaacgttgatatgcttgaagatctaag |
26833894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 45 - 117
Target Start/End: Original strand, 26786819 - 26786891
Alignment:
| Q |
45 |
atcatcaacgacatgcctaggcaaagaaacactgcaactctcagcaatggcacgatcaatggctctctgattt |
117 |
Q |
| |
|
|||||||| ||||||| |||||| | |||||||||| ||||||||| |||||||||||| || ||||| |||| |
|
|
| T |
26786819 |
atcatcaatgacatgcttaggcagataaacactgcagctctcagcattggcacgatcaaaggttctcttattt |
26786891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University