View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3577_low_23 (Length: 229)
Name: NF3577_low_23
Description: NF3577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3577_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 220
Target Start/End: Complemental strand, 52350465 - 52350254
Alignment:
| Q |
9 |
gttattacctttgcttgctgctccttctcatttgccacatttccaccaaatcccgtaggcctatatgccctctctgaccttattttgattgtgtttctta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52350465 |
gttattacctttgcttgctgctccttctcatttgccacatttccaccaaatccggtaggcctatattccctctctgaccttattttgattgtgtttctta |
52350366 |
T |
 |
| Q |
109 |
tagctcagtgacaatatgagaaaaggttaccattaaactagattgacagatgtgttcgtcttgatcgaaagtatgagcctatgtgaattaagaaagttgt |
208 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52350365 |
tagctcagtgacaatatgggaaaaggttaccattaaactagattgacagatgtgttcgtcttgatcgaaagtatgagactatgtgaattaagaaagttgt |
52350266 |
T |
 |
| Q |
209 |
attagatttttt |
220 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52350265 |
attagatttttt |
52350254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University