View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3578_high_9 (Length: 307)
Name: NF3578_high_9
Description: NF3578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3578_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 286
Target Start/End: Original strand, 35341246 - 35341516
Alignment:
| Q |
15 |
tctccatctgcatcatacaccaaggaccaattgcacatgaaaaatatgcacagggttctattggaggtgaagtgcttactgnnnnnnnnatttctcctct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35341246 |
tctccatctgcatcatacaccaaggaccaattgcacatgaaaaatatgcacagggttctattggaggtgaagtgcttact-ttttttttatttctcctct |
35341344 |
T |
|
| Q |
115 |
tggaagaaaatagaattgaagcactagaagattcattaaaacatgcaaatttttaaggaatattgagaagaggaatgacacttcccataataatgggaag |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35341345 |
tggaagaaaatagaattgaagcactagaagattcattaaaacatgcaaatttttaaggaatattgagaagaggaatgacacttcccataataatgggaag |
35341444 |
T |
|
| Q |
215 |
gtgcatagaactgtggaatttaattgccaactagtcaaaagataatagttaaaaatggatacatagcatatt |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35341445 |
gtgcatagaactgtggaatttaattgccaactagtcaaaagataatagttaaaaatggatacatagcatatt |
35341516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University