View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3578_low_13 (Length: 263)
Name: NF3578_low_13
Description: NF3578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3578_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 14 - 250
Target Start/End: Original strand, 3948783 - 3949026
Alignment:
| Q |
14 |
agaagacatggttatgagtttgaaataaagtgaacaaaaa----gaagaatgtattctcaattggatggttttggaatgaagggttgtggtaatgggagt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
3948783 |
agaagacatggttatgagtttgaaataaagtgaaccaaaaagaagaagaatgtattctgaattggatggttatggaatga-gggttgtggtaatgggagt |
3948881 |
T |
|
| Q |
110 |
ggtgcctttatactaaaaatcaatgagaatatgtggtaatgggagtggtagtagcattgtaatatacggaattactccattatgttgcaaaatattc--- |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3948882 |
ggtgcctttatactaaaaatcaatgagaatatgtggtaatgggagtggtagtagcattgtaatatacggaattactccattatgttgcaaaatattcttt |
3948981 |
T |
|
| Q |
207 |
ttttttaaaaact-ttcattttaagggataatgcataatatatat |
250 |
Q |
| |
|
|||||||||| || |||| ||| |||||||||||||||||||||| |
|
|
| T |
3948982 |
ttttttaaaagctattcactttgagggataatgcataatatatat |
3949026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University