View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3579_high_12 (Length: 287)
Name: NF3579_high_12
Description: NF3579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3579_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 139 - 271
Target Start/End: Original strand, 45394647 - 45394779
Alignment:
| Q |
139 |
gaggagaaagttggagtgaatcaccgatctatatcttgaatggtagggtcaagcaatttatttatctgaaatatgaaattaaatatacttaattgctatt |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45394647 |
gaggagaaagtttgagtgaatcaccgatctatatcttgaatggtagggtcaagcaatttatttatctgaaatatgaaattaaatatacttaattgctatt |
45394746 |
T |
 |
| Q |
239 |
gttcttctgaataatttggagaacgattgattg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45394747 |
gttcttctgaataatttggagaacgattgattg |
45394779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 13 - 86
Target Start/End: Original strand, 45394521 - 45394594
Alignment:
| Q |
13 |
aatatccgtttatttcaagtaaatggagatgattttttcccacaattaggagagcacatattagggggaccggt |
86 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45394521 |
aatatccatttatttcaagtaaatggagatgattttttcccacaattaggagagcacatattagggggaccggt |
45394594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University