View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3579_low_14 (Length: 289)
Name: NF3579_low_14
Description: NF3579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3579_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 11 - 262
Target Start/End: Complemental strand, 52472188 - 52471937
Alignment:
| Q |
11 |
cataggcaacaatcgacgggtgagactgcctccttctataccttgctgaatggtgttactaagaaggatggggttttaaattggctaacaaaagaagggt |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472188 |
cataggcaacaatcgacggatgagactgcctccttctataccttgctgaatggtgttactaagaaggatggggttttaaattggctaacaaaagaagggt |
52472089 |
T |
 |
| Q |
111 |
gagtttctgtctaaacagcagcaagcagacatgacagttactatacggtgttaaaagagatcacaaaacacgtctcactgtaccaccacactcagcctat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472088 |
gagtttctgtctaaacagcagcaagcagacatgacagttactatacggtgttaaaagagatcacaaaacacgtctcactgtaccaccacactcagcctat |
52471989 |
T |
 |
| Q |
211 |
attctctcccaatgttgggcttccaagggcctcaatccaacacttggaccat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52471988 |
attctctcccaatgttgggcttccaagggcctcaatccaacacttggaccat |
52471937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University