View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3581_high_14 (Length: 230)
Name: NF3581_high_14
Description: NF3581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3581_high_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 32 - 180
Target Start/End: Original strand, 15987765 - 15987916
Alignment:
| Q |
32 |
gagttgtgaatgaaaatggagaagaaaggtttta----ttaatttggtgggttaggggtgtgtgtgtaatttatttggaataagaaaatgtgtaaaatat |
127 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15987765 |
gagttgtgaatgaaaatggagaa-aaaggttttatttattaatttggtgggttaggggtgtgtgtgtaatttatttggaataagaaaatgtgtaaaatat |
15987863 |
T |
 |
| Q |
128 |
agggatgtgtgtgtgagtggggaattttgtattggttgattcgaaaattgagg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15987864 |
agggatgtgtgtgtgagtggggaattttgtattggttgattcgaaaattgagg |
15987916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University