View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3581_high_2 (Length: 406)

Name: NF3581_high_2
Description: NF3581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3581_high_2
NF3581_high_2
[»] scaffold0179 (2 HSPs)
scaffold0179 (63-160)||(33197-33294)
scaffold0179 (226-285)||(33076-33135)
[»] chr7 (1 HSPs)
chr7 (283-387)||(33563558-33563662)
[»] chr1 (2 HSPs)
chr1 (19-68)||(47289178-47289227)
chr1 (81-160)||(47289107-47289183)


Alignment Details
Target: scaffold0179 (Bit Score: 86; Significance: 5e-41; HSPs: 2)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 33294 - 33197
Alignment:
63 gagacagagtgagttggagagacaacgacggtgggcatcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag 160  Q
    |||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33294 gagacagagttagttggagagacaatgacggtgggcttcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag 33197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 226 - 285
Target Start/End: Complemental strand, 33135 - 33076
Alignment:
226 ccactatggcaaatgatgccacatgggatgtgtgtagggtgtgtatggttcaaaagggat 285  Q
    |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||    
33135 ccactatgacaaatgatgccacatgggatgtgtgtatggtgtgtatggttcaaaagggat 33076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 283 - 387
Target Start/End: Complemental strand, 33563662 - 33563558
Alignment:
283 gattataactacaagaaagaatcatgtagccattgaactgccatgataaaatggaacccaacagataataattggagccaatagcatcatcatcaatcca 382  Q
    ||||||||| |||||||| | || | ||||||||||||||| || ||||||||||||||||| | ||| |||||||||||| |||| ||  |||||||||    
33563662 gattataacgacaagaaatattcctatagccattgaactgctataataaaatggaacccaactgctaacaattggagccaacagcagcagtatcaatcca 33563563  T
383 tctac 387  Q
     ||||    
33563562 actac 33563558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 47289227 - 47289178
Alignment:
19 catgagaaaatgaagagagtgggaggagatcgagcggttgggaggagaca 68  Q
    |||||| ||| |||||||||||||||||||||||||||||||||||||||    
47289227 catgaggaaacgaagagagtgggaggagatcgagcggttgggaggagaca 47289178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 81 - 160
Target Start/End: Complemental strand, 47289183 - 47289107
Alignment:
81 gagacaacgacggtgggcatcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag 160  Q
    ||||||| |||| ||||| ||||||||||| |||||||||||||||| |||| |||| ||||   |||||||||||||||    
47289183 gagacaaagacgatgggcttcatccccgaacttagggaaagagggatcgaactgagagcaag---ggcacaaagtttcag 47289107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University