View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3581_high_2 (Length: 406)
Name: NF3581_high_2
Description: NF3581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3581_high_2 |
 |  |
|
| [»] scaffold0179 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0179 (Bit Score: 86; Significance: 5e-41; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 63 - 160
Target Start/End: Complemental strand, 33294 - 33197
Alignment:
| Q |
63 |
gagacagagtgagttggagagacaacgacggtgggcatcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag |
160 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33294 |
gagacagagttagttggagagacaatgacggtgggcttcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag |
33197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 226 - 285
Target Start/End: Complemental strand, 33135 - 33076
Alignment:
| Q |
226 |
ccactatggcaaatgatgccacatgggatgtgtgtagggtgtgtatggttcaaaagggat |
285 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33135 |
ccactatgacaaatgatgccacatgggatgtgtgtatggtgtgtatggttcaaaagggat |
33076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 283 - 387
Target Start/End: Complemental strand, 33563662 - 33563558
Alignment:
| Q |
283 |
gattataactacaagaaagaatcatgtagccattgaactgccatgataaaatggaacccaacagataataattggagccaatagcatcatcatcaatcca |
382 |
Q |
| |
|
||||||||| |||||||| | || | ||||||||||||||| || ||||||||||||||||| | ||| |||||||||||| |||| || ||||||||| |
|
|
| T |
33563662 |
gattataacgacaagaaatattcctatagccattgaactgctataataaaatggaacccaactgctaacaattggagccaacagcagcagtatcaatcca |
33563563 |
T |
 |
| Q |
383 |
tctac |
387 |
Q |
| |
|
|||| |
|
|
| T |
33563562 |
actac |
33563558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 47289227 - 47289178
Alignment:
| Q |
19 |
catgagaaaatgaagagagtgggaggagatcgagcggttgggaggagaca |
68 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47289227 |
catgaggaaacgaagagagtgggaggagatcgagcggttgggaggagaca |
47289178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 81 - 160
Target Start/End: Complemental strand, 47289183 - 47289107
Alignment:
| Q |
81 |
gagacaacgacggtgggcatcatccccgaatttagggaaagagggatggaaccgagaacaagggaggcacaaagtttcag |
160 |
Q |
| |
|
||||||| |||| ||||| ||||||||||| |||||||||||||||| |||| |||| |||| ||||||||||||||| |
|
|
| T |
47289183 |
gagacaaagacgatgggcttcatccccgaacttagggaaagagggatcgaactgagagcaag---ggcacaaagtttcag |
47289107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University