View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3581_high_4 (Length: 346)
Name: NF3581_high_4
Description: NF3581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3581_high_4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 17 - 346
Target Start/End: Original strand, 45036133 - 45036462
Alignment:
| Q |
17 |
aacggtgattacgtgaaaggtgtaataggtttggcgaaaggtttgcggaaggtgatgacggcgtatccgctggttgtggcggtgcttccagatgtaccgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45036133 |
aacggtgattacgtgaaaggtgtaataggtttggcgaaaggtttgcggaaggtgatgacggcgtatccgctggttgtggcggtgcttccagatgtaccgg |
45036232 |
T |
 |
| Q |
117 |
gggaacaccgtgggatgttggaagctcaggggtgtattgtccgtgagattgaaccgggtaacccacccggaaatcagactcagtttgctatggcgtatta |
216 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45036233 |
aggaacaccgtgagatgttggaagctcagggatgtattgtccgtgagattgaaccggttaacccacccgaaaatcagactcagtttgctatggcgtatta |
45036332 |
T |
 |
| Q |
217 |
cgtcatcaattattccaaactccgtatatgggaggtacactctacaggacactatgctattttcgtagtctgttatttctacacgtcatcaatcatttat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45036333 |
cgtcatcaattattccaaactccgtatatgggaggtacactctacaagacactatgctattttcgtagtctgttatttctacacgtcatcaatcatttat |
45036432 |
T |
 |
| Q |
317 |
ttctgctattgtttctttacacgtggaatt |
346 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
45036433 |
ttctgttattgtttctttacacgtggaatt |
45036462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University