View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_111 (Length: 244)
Name: NF3582_high_111
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_111 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 21 - 186
Target Start/End: Complemental strand, 37473868 - 37473702
Alignment:
| Q |
21 |
gccgttggggttgagtcggatcaaccgcattttgggagggaggnnnnnnn-ctgttcggagtctggtcacggacccgatcatgcggttgatactcaactt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37473868 |
gccgttggggttgagtcggatcaaccgcattttgggagggaggttttttttctgttcggagtctggtcacggacccgatcatgcggttgatactcaacat |
37473769 |
T |
 |
| Q |
120 |
aaagtggctgaggagactccggagaaggtatcccattcccgaagattaccctattgttggtttcgga |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37473768 |
aaagtggctgaggagactccggagaaggtatcccattcccgaagattaccctattgttggtttcgga |
37473702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 211 - 244
Target Start/End: Complemental strand, 37473677 - 37473644
Alignment:
| Q |
211 |
gatgaattgtttcaagagatgttgcagtgttgtt |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
37473677 |
gatgaattgtttcaagagatgttgtagtgttgtt |
37473644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 140
Target Start/End: Complemental strand, 37466382 - 37466330
Alignment:
| Q |
88 |
acggacccgatcatgcggttgatactcaacttaaagtggctgaggagactccg |
140 |
Q |
| |
|
||||||||||||||| ||||||| || || ||||| |||||||||||||||| |
|
|
| T |
37466382 |
acggacccgatcatgtggttgatgctgaagctaaagcggctgaggagactccg |
37466330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University