View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_123 (Length: 237)
Name: NF3582_high_123
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_123 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 43 - 229
Target Start/End: Complemental strand, 49842819 - 49842633
Alignment:
| Q |
43 |
attaaggatattattttctaaatttacacggtgctcctaaaatcttaggaatgatcctaattattattactcgcattcacataaaccacaacatgtcact |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49842819 |
attaaggatattattttctaaatttacacggtgctcctaaaatcttaggaacgatcctaattattattactcgcattcacataaaccacaacataccact |
49842720 |
T |
|
| Q |
143 |
ctattggatgttcttatgccgtcatttatccttttcttatgtcttccgtgactatatcgttaattatcggtctaatgttgatgatgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49842719 |
ctattggatgttcttatgccgtcatttatccttttcttatatcttccgtgattatatcgttgattatcggtctaatgttgatgatgt |
49842633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 49842914 - 49842872
Alignment:
| Q |
1 |
ttgacaatcatcaataataaatttttaaaaatcttaatcataa |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49842914 |
ttgacaatcatcaataataaatttttaaaaatcttaatcataa |
49842872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University