View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3582_high_132 (Length: 226)

Name: NF3582_high_132
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3582_high_132
NF3582_high_132
[»] chr7 (2 HSPs)
chr7 (134-206)||(8279140-8279212)
chr7 (151-196)||(8270475-8270520)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 134 - 206
Target Start/End: Original strand, 8279140 - 8279212
Alignment:
134 aatattcggaacgctgttttgatgggttggaccgagttttatattctaaataataaatcattaacgataactt 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8279140 aatattcggaacgctgttttgatgggttggaccgagttttatattctaaataataaatcattaacgataactt 8279212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 196
Target Start/End: Original strand, 8270475 - 8270520
Alignment:
151 tttgatgggttggaccgagttttatattctaaataataaatcatta 196  Q
    ||||||| ||| |||| ||||||||| |||||||||||||||||||    
8270475 tttgatgtgtttgaccaagttttataatctaaataataaatcatta 8270520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University