View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_132 (Length: 226)
Name: NF3582_high_132
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_132 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 134 - 206
Target Start/End: Original strand, 8279140 - 8279212
Alignment:
| Q |
134 |
aatattcggaacgctgttttgatgggttggaccgagttttatattctaaataataaatcattaacgataactt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8279140 |
aatattcggaacgctgttttgatgggttggaccgagttttatattctaaataataaatcattaacgataactt |
8279212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 151 - 196
Target Start/End: Original strand, 8270475 - 8270520
Alignment:
| Q |
151 |
tttgatgggttggaccgagttttatattctaaataataaatcatta |
196 |
Q |
| |
|
||||||| ||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
8270475 |
tttgatgtgtttgaccaagttttataatctaaataataaatcatta |
8270520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University