View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_134 (Length: 222)
Name: NF3582_high_134
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_134 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 99 - 204
Target Start/End: Original strand, 7257489 - 7257594
Alignment:
| Q |
99 |
atcataattttacagtacnnnnnnngagcgttactgttaatttccaccttgtctttcaattaggctttttaattaacagtttaaattcaataactagttc |
198 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7257489 |
atcataattttacagtactttttttgagcgttactgttaatttccaccttgtctttcaattaggctttttaattaatagtttaaattcaataactagttc |
7257588 |
T |
 |
| Q |
199 |
tccttg |
204 |
Q |
| |
|
|||||| |
|
|
| T |
7257589 |
tccttg |
7257594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University