View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_39 (Length: 419)
Name: NF3582_high_39
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 20 - 409
Target Start/End: Original strand, 42183835 - 42184224
Alignment:
| Q |
20 |
aatagtcatcatcaaatcaaaaaggctcgttgtgattctaaccctttttctgtgcctgattttactatggctgctcctaatccaactacaagaaaatatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
42183835 |
aatagtcatcatcaaatcaaaaaggctcgttgtgattctaaccctttttctgtgcctgattttactgtggctgttcctaatccaactacaagaaaatatg |
42183934 |
T |
|
| Q |
120 |
gatcttcatcacattttcttgcttctactccccttcatccttatctccaatcttcccttgctttgcataatagcagctttgagggttcaaataagcaacc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42183935 |
gatcttcatcacattttcttgcttctactccccttcatccttatctccaatcttccctttctttgcataatagcagctttgagggttcaaataagcaacc |
42184034 |
T |
|
| Q |
220 |
aaggtgagtttatatctgtcttttgctatatctgtttagaatcacatgttttgattcatatcatatgagtttcatgaaatcaggttgccaatgtgatttt |
319 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42184035 |
aaggtgagtttatatctgtattttgctatatctgtttagaatcacatgttttgattcatatcatatgagtttcatgaaatcaggttgccaatgtgatttt |
42184134 |
T |
|
| Q |
320 |
gttgaaggcttaagcttcaaagtatagcttttgctaaaatctgtggttcttctaaatttatcatgaatccaaacatgtactatgcctatg |
409 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42184135 |
gttgaaggcttaagcttctaagtatagcttttgctaaaatctgtgattcttctaaatttatcatgaatccaaacatgtactatgcctatg |
42184224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University