View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_55 (Length: 334)
Name: NF3582_high_55
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 26933050 - 26932733
Alignment:
| Q |
1 |
ttggtatacttttgatagttggactctccgcacaaattgcgggacaatcttcttttatcattgcgttttggtttggtttgtttttgccggatggtcctcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26933050 |
ttggtatacttttgatagttggactctccgcacaaattgcgggacaatcttcttttatcattgcgttttggtttggtttgtttttgccggatggtcctcc |
26932951 |
T |
 |
| Q |
101 |
tttaggttctattttgagtgaaagacttggtactattggttctactttgactgttccagcttattgtactattagtgggttgaggacaaaagttcctaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26932950 |
tttaggttctattttgagtgaaagacttggtactattggttctactttgactgttccagcttattgtactattagtgggttgaggacaaaagttcctaat |
26932851 |
T |
 |
| Q |
201 |
ttagtagggccaaaaatagcattcatggaggttatcataattgctgggtatataggaaaatttgttggaaccattataccatcactttactttcatattg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26932850 |
ttagtagggccaaaaatagcattcatggaggttatcataattgctgggtatataggaaaatttgttggaaccattataccatcactttactttcatattg |
26932751 |
T |
 |
| Q |
301 |
aattttgggattcctttg |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
26932750 |
aattttgggattcctttg |
26932733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University