View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_62 (Length: 312)
Name: NF3582_high_62
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 39135179 - 39135429
Alignment:
| Q |
1 |
gttatattataatttagaggcaactttaatcaataatgataatcannnnnnnnnngaggggtcaataatgataatcattgttgtttatatgttactatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39135179 |
gttatattataatttagaggcaactttaatcaataacgataatcgtttttttttttaggggtcaataatgataatcattgttgtttatatgttactatga |
39135278 |
T |
 |
| Q |
101 |
tttaattaatttctacaaccccacacattgtttgttcttatgaggaaattatttgcaattttggagtatcttttgtggaccccacacctctacacaacaa |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39135279 |
tttaattaatttctacaaccccgcacattgttttgttttatgaggaaattatttgcaattttggagtatcttttgtggaccccacacctccacacaacaa |
39135378 |
T |
 |
| Q |
201 |
actcattgctaccaaaaat---aacaaccttcgctttactcttctttgtat |
248 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39135379 |
actcattgctaccaaaaataacaacaaccttcgctttactcttctttgtat |
39135429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University