View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_84 (Length: 256)
Name: NF3582_high_84
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 242
Target Start/End: Complemental strand, 23982697 - 23982475
Alignment:
| Q |
20 |
tgaccctcaattgaaacctgactgcattgaccctcatgcaaataatcattccacccatgattaaacttcacacttcgatgatcctcattcaaccgaccct |
119 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23982697 |
tgaccctcaattgaaacctgattgcattgaccctcatgcaaataatcattccacccatgattaaacttcacacttcgatgatcctcattcaaccgaccgt |
23982598 |
T |
 |
| Q |
120 |
cgtttgaaacttcgcataacatatcctcataatgatcctcatcactcatctgatcatcctcatcttcattctgttgatgctcaggtactgaatcatcata |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23982597 |
cgtttgaaacttcgcataacatatcctcataatgatcctcatcactcatctgatcatcctcatcttcattctgttgatgctcaggtactgaatcatcata |
23982498 |
T |
 |
| Q |
220 |
caactgattctcatgcacatccc |
242 |
Q |
| |
|
|||||||| |||||||| ||||| |
|
|
| T |
23982497 |
caactgatcctcatgcatatccc |
23982475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 105 - 235
Target Start/End: Complemental strand, 23989390 - 23989263
Alignment:
| Q |
105 |
cattcaaccgaccctcgtttgaaacttcgcataacatatcctcataatgatcctcatcactcatctgatcatcctcatcttcattctgttgatgctcagg |
204 |
Q |
| |
|
||||||||||| |||| ||||||||||| ||||||||||| || ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23989390 |
cattcaaccgatcctcctttgaaacttcacataacatatcgtcgtaatgatcctcctcactcatctgatcatcctcatattcattctgttgatgctcagg |
23989291 |
T |
 |
| Q |
205 |
tactgaatcatcatacaactgattctcatgc |
235 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
23989290 |
---tgaatcatcatacaactgatcctcatgc |
23989263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 55
Target Start/End: Complemental strand, 23982724 - 23982689
Alignment:
| Q |
20 |
tgaccctcaattgaaacctgactgcattgaccctca |
55 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23982724 |
tgaccctcaattgaaacctgattgcattgaccctca |
23982689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University