View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_85 (Length: 255)
Name: NF3582_high_85
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_85 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 143 - 240
Target Start/End: Complemental strand, 27611795 - 27611698
Alignment:
| Q |
143 |
gcataagaaggcaggagtgtgcagtggtgctgtctctaataattgcatctttattgagttccgtgtcaactcagttgcattgcatcgatccaacaatc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27611795 |
gcataagaaggcaggagtgtgcagtggtgctgtctctaataattgcatctttattgagttccgtgtcaactcagttgcattgcatcgatccaacaatc |
27611698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 92
Target Start/End: Complemental strand, 27611895 - 27611836
Alignment:
| Q |
32 |
tttgtttcattaatttatctcttgggacattagataacattttccaattaatatttttagt |
92 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27611895 |
tttgtttcattaatttatctcttgg-acattagataacattttccaattaatatttttagt |
27611836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University