View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_89 (Length: 254)
Name: NF3582_high_89
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_89 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 161 - 243
Target Start/End: Complemental strand, 4537000 - 4536918
Alignment:
| Q |
161 |
tatgaatggctttgcaactgttgagaaatcgcacttcagcgtcaacgttcaatttgttcaccaatgctcttagacgtttctct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4537000 |
tatgaatggctttgcaactgttgagaaatcgcacttcagcgtcaacgttcaatttgttcaccaatgctcttagacgtttctct |
4536918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 84 - 113
Target Start/End: Complemental strand, 4537078 - 4537049
Alignment:
| Q |
84 |
gcttcactgcactgttgcaacttgtatatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4537078 |
gcttcactgcactgttgcaacttgtatatg |
4537049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University