View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_high_93 (Length: 251)
Name: NF3582_high_93
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_high_93 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 29 - 204
Target Start/End: Complemental strand, 32116067 - 32115892
Alignment:
| Q |
29 |
ctctttagattatatagtcacattactacattattattactgcagtagcaccttctgttctgtcccgaccaacccctcatgcgttgtcgtctcaccggcg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32116067 |
ctctttagattatatagtcacattactacattattattactgcagtagcaccttctgttctgtcccgaccaacccctcatgcgttgtcgtctcaccggcg |
32115968 |
T |
 |
| Q |
129 |
caacccatcaacttcgccggaaactttgctcaaaagggtcatccaattcactcatggctctcaattctcaacctta |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32115967 |
caacccatcaacttcgccggaaactttgctcaaaagggtcacccaattcactcatggctctcaattctcaacctta |
32115892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University