View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_112 (Length: 246)
Name: NF3582_low_112
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_112 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 14 - 229
Target Start/End: Original strand, 6505179 - 6505395
Alignment:
| Q |
14 |
gcagagactaattcctaagagttttaatgttggtgcatgttcaaggtttgatttgaatccagtaccttagttaagataaaagaaattcatatcatatcat |
113 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
6505179 |
gcagagactaattcctaaaaattttaatgttggtgcatgttcaaggtttgatttgaatccagtgccttagttaaactaaaagaaattcatatcatatcat |
6505278 |
T |
|
| Q |
114 |
ttaagcattattgggtaaacaaatt-aaacgtttacaacaggaagcaattttcttagtcattgaatatgcataataggacatatttgcagcaagttgttg |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6505279 |
ctaagcattattgggtaaacaaattaaaacgtttatcataggaagcaattttcttagtcattgaatatgcataataggacatatttgcagcaagttgttg |
6505378 |
T |
|
| Q |
213 |
cttaaactgttggttgt |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6505379 |
cttaaactgttggttgt |
6505395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University