View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3582_low_115 (Length: 244)

Name: NF3582_low_115
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3582_low_115
NF3582_low_115
[»] chr1 (3 HSPs)
chr1 (21-186)||(37473702-37473868)
chr1 (211-244)||(37473644-37473677)
chr1 (88-140)||(37466330-37466382)


Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 21 - 186
Target Start/End: Complemental strand, 37473868 - 37473702
Alignment:
21 gccgttggggttgagtcggatcaaccgcattttgggagggaggnnnnnnn-ctgttcggagtctggtcacggacccgatcatgcggttgatactcaactt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||| |    
37473868 gccgttggggttgagtcggatcaaccgcattttgggagggaggttttttttctgttcggagtctggtcacggacccgatcatgcggttgatactcaacat 37473769  T
120 aaagtggctgaggagactccggagaaggtatcccattcccgaagattaccctattgttggtttcgga 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37473768 aaagtggctgaggagactccggagaaggtatcccattcccgaagattaccctattgttggtttcgga 37473702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 211 - 244
Target Start/End: Complemental strand, 37473677 - 37473644
Alignment:
211 gatgaattgtttcaagagatgttgcagtgttgtt 244  Q
    |||||||||||||||||||||||| |||||||||    
37473677 gatgaattgtttcaagagatgttgtagtgttgtt 37473644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 140
Target Start/End: Complemental strand, 37466382 - 37466330
Alignment:
88 acggacccgatcatgcggttgatactcaacttaaagtggctgaggagactccg 140  Q
    ||||||||||||||| ||||||| || ||  ||||| ||||||||||||||||    
37466382 acggacccgatcatgtggttgatgctgaagctaaagcggctgaggagactccg 37466330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University