View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_122 (Length: 237)
Name: NF3582_low_122
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_122 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 52913025 - 52912826
Alignment:
| Q |
1 |
agctgccattgtccaccagcggctatagctggagatggaatggtgacggtggttgatattataataatgagagggataagaagatgaatggggagaagtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52913025 |
agctgccattgtccaccagcggctatagctggagatggaatggtgaaggtggttgatattataataatgagagggataagaagatgaatggggaaaagtg |
52912926 |
T |
|
| Q |
101 |
aatgagtcatttaatttggtggtgggtttagtttaggaataagtataagctttatgtgtggatttctatctttttctttatgagtctgtgacagaactgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52912925 |
aatgagtcatttaatttggtggtgggtttag-------------------tttatgtgtggatttctatctttttctttatgagtctgtgacagaactgt |
52912845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University