View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_128 (Length: 237)
Name: NF3582_low_128
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_128 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 4 - 221
Target Start/End: Complemental strand, 18340231 - 18340014
Alignment:
| Q |
4 |
ctcttagatgatccgcttaaccaatactttgccctagtttcgcaacactgtgttccgcttttgtcgtttcgattcgtttatacctacctttttaaaaatc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18340231 |
ctcttagatgatccgcttaaccaatactttgccctagtttctcaacactgtgttccgctcttgtcgtttcgattcgtttataactacctttttaaaaatc |
18340132 |
T |
|
| Q |
104 |
agttaatgtcgttagcgagtttctctgactttaacttgctttaccctagctttattgagattctctctgaggatccgaatctctacgagcgttataacgc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18340131 |
agttaatgtcgttagcgagtttctctgactttaacttgctttaccctagctttattgagattctctctgaggatccgaatctctacgagcgttataacgc |
18340032 |
T |
|
| Q |
204 |
tcgtggagagaatgttat |
221 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
18340031 |
tcgtggagagaatgttat |
18340014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 175
Target Start/End: Complemental strand, 18345389 - 18345218
Alignment:
| Q |
4 |
ctcttagatgatccgcttaaccaatactttgccctagtttcgcaacactgtgttccgcttttgtcgtttcgattcgtttatacctacctttttaaaaatc |
103 |
Q |
| |
|
||||||||||| || || |||||||||||||| || | || |||| ||| |||| || || || |||| |||| |||||| ||||||||||||||||| |
|
|
| T |
18345389 |
ctcttagatgacccactgaaccaatactttgcacttatctcccaacgttgtattccactcttctcatttcaattcatttataactacctttttaaaaatc |
18345290 |
T |
|
| Q |
104 |
agttaatgtcgttagcgagtttctctgactttaacttgctttaccctagctttattgagattctctctgagg |
175 |
Q |
| |
|
| ||| || || || | || ||||| |||||| | || |||||||||| ||||||||||||||| |||| |
|
|
| T |
18345289 |
aactaaaatcatttgcaaattcgtctgaatttaacctactgtaccctagctatattgagattctctcagagg |
18345218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 96
Target Start/End: Original strand, 18303491 - 18303566
Alignment:
| Q |
21 |
taaccaatactttgccctagtttcgcaacactgtgttccgcttttgtcgtttcgattcgtttatacctaccttttt |
96 |
Q |
| |
|
|||||||||||||||| |||| || ||||| ||| |||| || || ||||||||||| ||||||| || ||||||| |
|
|
| T |
18303491 |
taaccaatactttgccttagtctcccaacattgtattccactcttctcgtttcgatttgtttataactcccttttt |
18303566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University