View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_131 (Length: 231)
Name: NF3582_low_131
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_131 |
 |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 34461590 - 34461789
Alignment:
| Q |
19 |
tgataagcagcacatacagtgtgaagaagcctctcaatgattccatttatggagctcatagtgaatttatggtagccctaaaatatgtcacactcctaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34461590 |
tgataagcagcacatacagtgtgaagaagcctctcaatgattccatttatggagctcatagtgaatttatggtagccctaaaatatgtcacactcctaac |
34461689 |
T |
 |
| Q |
119 |
tatattcttattctcatttttctgtcacacattgtccattaggtttttcaaccaagtaagcatcctcatttgcacaccacaagatgtcttgtcctatgct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34461690 |
tatattcttattctcatttttctgtcacacattgtccattaggtttttcaaccaagtaagcatcctcatttgcacaccacaagatgtcttgtcctatgct |
34461789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 136
Target Start/End: Complemental strand, 1149837 - 1149722
Alignment:
| Q |
21 |
ataagcagcacatacagtgtgaagaagcctctcaatgattccatttatggagctcatagtgaatttatggtagccctaaaatatgtcacactcctaacta |
120 |
Q |
| |
|
|||||||||||||| |||||||| ||||| || |||||| | ||||||||||| ||| ||||||| ||||| || |||||||||||| ||||||| || | |
|
|
| T |
1149837 |
ataagcagcacatatagtgtgaaaaagccactaaatgatgcaatttatggagcacatggtgaattcatggttgcactaaaatatgtctcactcctcacaa |
1149738 |
T |
 |
| Q |
121 |
tattcttattctcatt |
136 |
Q |
| |
|
| ||| | |||||||| |
|
|
| T |
1149737 |
ttttcctcttctcatt |
1149722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 81 - 204
Target Start/End: Original strand, 21638 - 21761
Alignment:
| Q |
81 |
gaatttatggtagccctaaaatatgtcacactcctaactatattcttattctcatttttctgtcacacattgtccattaggtttttcaaccaagtaagca |
180 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| || || ||||||||||||||||||||||| ||||| | || ||||||||| |||||||| ||||| |
|
|
| T |
21638 |
gaatttatggaagccctaaaatatgtgacacttcttaccatattcttattctcatttttctgccacactctttcaattaggtttctcaaccaattaagcc |
21737 |
T |
 |
| Q |
181 |
tcctcatttgcacaccacaagatg |
204 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
21738 |
tccttatttgcacaccacaagatg |
21761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University