View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_141 (Length: 216)
Name: NF3582_low_141
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_141 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 10011371 - 10011546
Alignment:
| Q |
15 |
cacagagcttggatttggacaacaatgaggggtgttcatcttttgcagaaaaaataagaaatcctcggtgatcattgaatcgatccaaaacatgtcgtaa |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10011371 |
cacagagcttggatttggacaacaaagaggggtgttcatcttttgcagaaaaaataagaaatcctcggtgatcattgaatcgatccaaaacatgtcgtaa |
10011470 |
T |
 |
| Q |
115 |
atttcgttgttgatgaaggttgatgaaagattctggcggagaacatgcagctatgcagatggcattgaagagttggatagatactg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
10011471 |
atttcgtt----------gttgatgaaagattctggcggagaacatgcagctatggagatggcattgaagagttggatggatactg |
10011546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University