View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_144 (Length: 212)
Name: NF3582_low_144
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_144 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 49 - 194
Target Start/End: Complemental strand, 1608994 - 1608849
Alignment:
| Q |
49 |
cacattttcctataattcattgaccatagcgaggaaaaagaaaagtgtctcacaaatagtaaaaccttcaaactttaccaaatttcaatttaattactct |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1608994 |
cacattttcctataattcattgaccatagcgaggaaaaagaaaagtgtctcacaaatagtaaaaccttcaaactttaccaaatttcaatttaattactct |
1608895 |
T |
|
| Q |
149 |
gcaaatttcaaactttacaaaatctcataaaaactcatttctcact |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1608894 |
gcaaatttcaaactttacaaaatctcataaaaactcatttctcact |
1608849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University