View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_148 (Length: 205)
Name: NF3582_low_148
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_148 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 35164785 - 35164615
Alignment:
| Q |
18 |
atagctattataaaacttgacattctttgctcgtcgttgggtgaaatgtatcttctctaacaccggttgaaagcctttgattaaactcgtggttgactga |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35164785 |
atagctattataaaacttgatattctttgctcgtcgttgggtgaaatgtatcttctctaacacttgttgaaagcctttgattaaactcgtggttgactga |
35164686 |
T |
|
| Q |
118 |
aaggtacattctctaatttgattaaactttcatttattctcctaaaacttctactaacgtgtgtcatagtt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
35164685 |
aaggtacattctctaatttgattaaactttcatttattctcctaaaactcctactaacgtgtgtcgtagtt |
35164615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University