View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_22 (Length: 480)
Name: NF3582_low_22
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 219
Target Start/End: Complemental strand, 32512333 - 32512128
Alignment:
| Q |
14 |
aacctgtgcatgtttagatttgctgtgagttagataggattatggtgagtcactgcgacatgcaaaagctatagcttgtggcttctacaaaatcacggcg |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32512333 |
aacccgtgcatgtttagatttgctgtgagttagataggattatggtgagtcactgcgacatgcaaaagctatagcttgtggcttctacaaaatcacggcg |
32512234 |
T |
|
| Q |
114 |
ccactttgatttgttattgcattatgtggttaatttactatttttaacatgaaaatgagcaagtgaatgcatggaaggtacttccagtgacatatatatg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32512233 |
ccactttgatttgttattgcattatgtggttaatttactatttttgacatgaaaatgagcaagtgaatgcatggaaggtacttccagagacatatatatg |
32512134 |
T |
|
| Q |
214 |
atgttc |
219 |
Q |
| |
|
|||||| |
|
|
| T |
32512133 |
atgttc |
32512128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 289 - 401
Target Start/End: Complemental strand, 32512051 - 32511939
Alignment:
| Q |
289 |
cttggtggaacatcattgtcaatgtttggttgatgtttgcttttagcatcaaagttttggtaccactcccagttgtaacacatattctgttctcagtggg |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32512051 |
cttggtggaacatcattgtcaatgtttggttgatgtttgcttttagcatcaaagttctggtaccactcccagttgtaacacatattctgttctcagtggg |
32511952 |
T |
|
| Q |
389 |
ttctagcaatgac |
401 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32511951 |
ttctagcaatgac |
32511939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University