View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3582_low_63 (Length: 312)

Name: NF3582_low_63
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3582_low_63
NF3582_low_63
[»] chr2 (1 HSPs)
chr2 (1-248)||(39135179-39135429)


Alignment Details
Target: chr2 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 39135179 - 39135429
Alignment:
1 gttatattataatttagaggcaactttaatcaataatgataatcannnnnnnnnngaggggtcaataatgataatcattgttgtttatatgttactatga 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||            ||||||||||||||||||||||||||||||||||||||||||||    
39135179 gttatattataatttagaggcaactttaatcaataacgataatcgtttttttttttaggggtcaataatgataatcattgttgtttatatgttactatga 39135278  T
101 tttaattaatttctacaaccccacacattgtttgttcttatgaggaaattatttgcaattttggagtatcttttgtggaccccacacctctacacaacaa 200  Q
    |||||||||||||||||||||| ||||||||||  | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
39135279 tttaattaatttctacaaccccgcacattgttttgttttatgaggaaattatttgcaattttggagtatcttttgtggaccccacacctccacacaacaa 39135378  T
201 actcattgctaccaaaaat---aacaaccttcgctttactcttctttgtat 248  Q
    |||||||||||||||||||   |||||||||||||||||||||||||||||    
39135379 actcattgctaccaaaaataacaacaaccttcgctttactcttctttgtat 39135429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University