View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3582_low_64 (Length: 311)

Name: NF3582_low_64
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3582_low_64
NF3582_low_64
[»] chr2 (1 HSPs)
chr2 (11-292)||(43900950-43901231)


Alignment Details
Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 11 - 292
Target Start/End: Original strand, 43900950 - 43901231
Alignment:
11 cagagaacattgcaatttattggggtcaaaataacaatgagggtaccctaacagaaacatgtgcaaaaggaaactacaacaactactcctatgtaatcat 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43900950 cagagaacattgcaatttattggggtcaaaataacaatgagggtaccctaacagaaacatgtgcaaaaggaaactacaacaactactcctatgtaatcat 43901049  T
111 agcttttcttaacaaatttgggaatggaacaacacctgaaatcaacttagcagatcattgtgacccttcttccaatgattgcacaatgttaagcacacac 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43901050 agcttttcttaacaaatttgggaatggaacaacacctgaaatcaacttagcagatcattgtgacccttcttccaatgattgcacaatgttaagcacacac 43901149  T
211 attaagaattgccaaatgaaaaggatcaaagtcttgctttcaattggcggagcagatggagaatatggtttaggttccactg 292  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43901150 attaagaattgccaaatgaaaaggatcaaagtcttgctttcaattggcggagcagatggagaatatggtttaggttccactg 43901231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University