View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_64 (Length: 311)
Name: NF3582_low_64
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_64 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 11 - 292
Target Start/End: Original strand, 43900950 - 43901231
Alignment:
| Q |
11 |
cagagaacattgcaatttattggggtcaaaataacaatgagggtaccctaacagaaacatgtgcaaaaggaaactacaacaactactcctatgtaatcat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900950 |
cagagaacattgcaatttattggggtcaaaataacaatgagggtaccctaacagaaacatgtgcaaaaggaaactacaacaactactcctatgtaatcat |
43901049 |
T |
 |
| Q |
111 |
agcttttcttaacaaatttgggaatggaacaacacctgaaatcaacttagcagatcattgtgacccttcttccaatgattgcacaatgttaagcacacac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43901050 |
agcttttcttaacaaatttgggaatggaacaacacctgaaatcaacttagcagatcattgtgacccttcttccaatgattgcacaatgttaagcacacac |
43901149 |
T |
 |
| Q |
211 |
attaagaattgccaaatgaaaaggatcaaagtcttgctttcaattggcggagcagatggagaatatggtttaggttccactg |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43901150 |
attaagaattgccaaatgaaaaggatcaaagtcttgctttcaattggcggagcagatggagaatatggtttaggttccactg |
43901231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University