View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3582_low_72 (Length: 287)
Name: NF3582_low_72
Description: NF3582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3582_low_72 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 162
Target Start/End: Original strand, 34852285 - 34852430
Alignment:
| Q |
17 |
aaaaggaaaacctgtatgatgtttctagcggctgccttcgtccctacgatgacacggcaaggttttgctttttccggggagttgagttccgatcgtttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34852285 |
aaaaggaaaacctgtatgatgtttctagcggctgccttcgtccctacgatgacacggcaaggttttgctttttccggggagttgagttccgatcgtttct |
34852384 |
T |
 |
| Q |
117 |
gatacaactaataagggttttgtgacttgatgaggtgcttgctgag |
162 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34852385 |
gatacaactaataagggttttgtgatttgatgaggtgcttgctgag |
34852430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University